Abstract

This paper presents a novel optical processing approach for exploring genome sequences built upon an optical correlator for global alignment and the extended dual-vector-curve (DV-curve) method for local alignment. To overcome the problem of the traditional DV-curve method for presenting an accurate and simplified output, we propose the hybrid amplitude wavelength polarization optical DV-curve (HAWPOD) method, built upon the DV-curve method, to analyze genome sequences in three steps: DNA coding, alignment, and post-analysis. For this purpose, a tunable graphene-based color filter is designed for wavelength modulation of optical signals. Moreover, all-optical implementation of the HAWPOD method is developed, while its accuracy is validated through numerical simulations in LUMERICAL FDTD. The results express that the proposed method is much faster than its electrical counterparts.

© 2018 Optical Society of America

Full Article  |  PDF Article

Corrections

5 November 2018: A typographical correction was made to the abstract.


OSA Recommended Articles
High-speed all-optical DNA local sequence alignment based on a three-dimensional artificial neural network

Ehsan Maleki, Hossein Babashah, Somayyeh Koohi, and Zahra Kavehvash
J. Opt. Soc. Am. A 34(7) 1173-1186 (2017)

String data alignment by a spatial coding and moiré technique

Jun Tanida
Opt. Lett. 24(23) 1681-1683 (1999)

Analysis of DNA sequences by an optical time-integrating correlator

N. Brousseau, R. Brousseau, J. W. A. Salt, L. Gutz, and M. D. B. Tucker
Appl. Opt. 31(23) 4802-4815 (1992)

References

  • View by:
  • |
  • |
  • |

  1. A. Lesk, Introduction to Bioinformatics (Oxford University, 2013).
  2. A. J. Griffiths, An Introduction to Genetic Analysis (Macmillan, 2005).
  3. A. D. Baxevanis and B. F. Ouellette, Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Vol. 43 of Methods of Biochemical Analysis (Wiley, 2004).
  4. N. G. Smith and A. Eyre-Walker, “Human disease genes: patterns and predictions,” Gene 318, 169–175 (2003).
    [Crossref]
  5. C. A. Kaiser, M. Krieger, H. Lodish, and A. Berk, Molecular Cell Biology (WH Freeman, 2007).
  6. R. Giegerich and D. Wheeler, “Pairwise sequence alignment,” (VCNS Biocomputing Division, University of Bielefeld, 1996).
  7. R. W. Taylor and D. M. Turnbull, “Mitochondrial DNA mutations in human disease,” Nat. Rev. Genet. 6, 389–402 (2005).
    [Crossref]
  8. S. Kaisler, F. Armour, J. A. Espinosa, and W. Money, “Big data: issues and challenges moving forward,” in 46th Hawaii International Conference on System Sciences (HICSS) (IEEE, 2013), pp. 995–1004.
  9. M. P. Kaźmierkowski, R. Krishnan, and F. Blaabjerg, Control in Power Electronics: Selected Problems (Academic, 2002).
  10. E. Pop, S. Sinha, and K. E. Goodson, “Heat generation and transport in nanometer-scale transistors,” Proc. IEEE 94, 1587–1601 (2006).
    [Crossref]
  11. Z.-J. Zhang, “Dv-curve: a novel intuitive tool for visualizing and analyzing DNA sequences,” Bioinformatics 25, 1112–1117 (2009).
    [Crossref]
  12. E. Maleki, H. Babashah, S. Koohi, and Z. Kavehvash, “High-speed all-optical DNA local sequence alignment based on a three-dimensional artificial neural network,” J. Opt. Soc. Am. A 34, 1173–1186 (2017).
    [Crossref]
  13. F. Mozafari, H. Babashah, S. Koohi, and Z. Kavehvash, “Speeding up DNA sequence alignment by optical correlator,” Opt. Laser Technol. 108, 124–135 (2018).
    [Crossref]
  14. A. Alqallaf and A. Cherri, “DNA sequencing using optical joint Fourier transform,” Optik 127, 1929–1936 (2016).
    [Crossref]
  15. V. O. Polyanovsky, M. A. Roytberg, and V. G. Tumanyan, “Comparative analysis of the quality of a global algorithm and a local algorithm for alignment of two sequences,” Algorithms Mol. Biol. 6, 25 (2011).
    [Crossref]
  16. R. C. Edgar, “Muscle: multiple sequence alignment with high accuracy and high throughput,” Nucleic Acids Res. 32, 1792–1797 (2004).
    [Crossref]
  17. V. Likic, “The Needleman-Wunsch algorithm for sequence alignment,” in 7th Melbourne Bioinformatics Course (Bi021 Molecular Science and Biotechnology Institute, University of Melbourne, 2008), pp. 1–46.
  18. D. W. Mount, “Using the Basic Local Alignment Search Tool (BLAST),” Cold Spring Harbor Protoc. 2007, pdb.top17 (2007).
    [Crossref]
  19. R. Mott, Smith–Waterman Algorithm (eLS, 2005).
  20. R. Bellman, Dynamic Programming (Courier, 2013).
  21. R. E. Bellman and S. E. Dreyfus, Applied Dynamic Programming (Princeton University, 2015).
  22. A. Grama, Introduction to Parallel Computing (Pearson Education, 2003).
  23. S. Akhter and J. Roberts, Multi-Core Programming (Intel, 2006), Vol. 33.
  24. Y. Jiang, P. T. DeVore, and B. Jalali, “Analog optical computing primitives in silicon photonics,” Opt. Lett. 41, 1273–1276 (2016).
    [Crossref]
  25. Y. Sun and X. Fan, “Optofluidic lasers for DNA mutation detection,” in Laser Science (Optical Society of America, 2012), paper LTh4F-1.
  26. K. A. Goldberg, P. Naulleau, and J. Bokor, “Fourier transform interferometer alignment method,” Appl. Opt. 41, 4477–4483 (2002).
    [Crossref]
  27. L. Wouters, H. W. Göhlmann, L. Bijnens, S. U. Kass, G. Molenberghs, and P. J. Lewi, “Graphical exploration of gene expression data: a comparative study of three multivariate methods,” Biometrics 59, 1131–1139 (2003).
    [Crossref]
  28. K. Plataniotis and A. N. Venetsanopoulos, Color Image Processing and Applications (Springer, 2013).
  29. M. Randić, M. Vračko, N. Lerš, and D. Plavšić, “Analysis of similarity/dissimilarity of DNA sequences based on novel 2-D graphical representation,” Chem. Phys. Lett. 371, 202–207 (2003).
    [Crossref]
  30. B. Liao and T.-M. Wang, “New 2D graphical representation of DNA sequences,” J. Comput. Chem. 25, 1364–1368 (2004).
    [Crossref]
  31. C. Yuan, B. Liao, and T.-M. Wang, “New 3D graphical representation of DNA sequences and their numerical characterization,” Chem. Phys. Lett. 379, 412–417 (2003).
    [Crossref]
  32. N. Jafarzadeh and A. Iranmanesh, “C-curve: a novel 3D graphical representation of DNA sequence based on codons,” Math. Biosci. 241, 217–224 (2013).
    [Crossref]
  33. X. Tang, P. Zhou, and W. Qiu, “On the similarity/dissimilarity of DNA sequences based on 4D graphical representation,” Chin. Sci. Bull. 55(8), 701–704 (2010).
    [Crossref]
  34. M. C. Saldías, F. V. Sassarini, C. M. Poblete, A. V. Vásquez, and I. M. Butler, “Image correlation method for DNA sequence alignment,” PloS One 7, e39221 (2012).
    [Crossref]
  35. W.-L. Hsu, J. Davis, R. Chipman, and S. Pau, “Compound dichroic polarizers with wavelength-dependent transmission axes,” Appl. Opt. 54, 6476–6481 (2015).
    [Crossref]
  36. A. Rhoads and K. F. Au, “PacBio sequencing and its applications,” Genomics, Proteomics Bioinf. 13, 278–289 (2015).
    [Crossref]
  37. A. Andryieuski and A. V. Lavrinenko, “Graphene metamaterials based tunable terahertz absorber: effective surface conductivity approach,” Opt. Express 21, 9144–9155 (2013).
    [Crossref]
  38. T. Ellenbogen, K. Seo, and K. B. Crozier, “Chromatic plasmonic polarizers for active visible color filtering and polarimetry,” Nano Lett. 12, 1026–1031 (2012).
    [Crossref]
  39. L. Anzagira and E. R. Fossum, “Color filter array patterns for small-pixel image sensors with substantial cross talk,” J. Opt. Soc. Am. A 32, 28–34 (2015).
    [Crossref]
  40. W. Pinthong, P. Muangruen, P. Suriyaphol, and D. Mairiang, “A simple grid implementation with Berkeley open infrastructure for network computing using blast as a model,” PeerJ 4, e2248 (2016).
    [Crossref]
  41. Y. Takaki and N. Okada, “Hologram generation by horizontal scanning of a high-speed spatial light modulator,” Appl. Opt. 48, 3255–3260 (2009).
    [Crossref]
  42. C. M. Watts, D. Shrekenhamer, J. Montoya, G. Lipworth, J. Hunt, T. Sleasman, S. Krishna, D. R. Smith, and W. J. Padilla, “Terahertz compressive imaging with metamaterial spatial light modulators,” Nat. Photonics 8, 605–609 (2014).
    [Crossref]
  43. M. Liu, X. Yin, and X. Zhang, “Double-layer graphene optical modulator,” Nano Lett. 12, 1482–1485 (2012).
    [Crossref]

2018 (1)

F. Mozafari, H. Babashah, S. Koohi, and Z. Kavehvash, “Speeding up DNA sequence alignment by optical correlator,” Opt. Laser Technol. 108, 124–135 (2018).
[Crossref]

2017 (1)

2016 (3)

Y. Jiang, P. T. DeVore, and B. Jalali, “Analog optical computing primitives in silicon photonics,” Opt. Lett. 41, 1273–1276 (2016).
[Crossref]

W. Pinthong, P. Muangruen, P. Suriyaphol, and D. Mairiang, “A simple grid implementation with Berkeley open infrastructure for network computing using blast as a model,” PeerJ 4, e2248 (2016).
[Crossref]

A. Alqallaf and A. Cherri, “DNA sequencing using optical joint Fourier transform,” Optik 127, 1929–1936 (2016).
[Crossref]

2015 (3)

2014 (1)

C. M. Watts, D. Shrekenhamer, J. Montoya, G. Lipworth, J. Hunt, T. Sleasman, S. Krishna, D. R. Smith, and W. J. Padilla, “Terahertz compressive imaging with metamaterial spatial light modulators,” Nat. Photonics 8, 605–609 (2014).
[Crossref]

2013 (2)

A. Andryieuski and A. V. Lavrinenko, “Graphene metamaterials based tunable terahertz absorber: effective surface conductivity approach,” Opt. Express 21, 9144–9155 (2013).
[Crossref]

N. Jafarzadeh and A. Iranmanesh, “C-curve: a novel 3D graphical representation of DNA sequence based on codons,” Math. Biosci. 241, 217–224 (2013).
[Crossref]

2012 (3)

T. Ellenbogen, K. Seo, and K. B. Crozier, “Chromatic plasmonic polarizers for active visible color filtering and polarimetry,” Nano Lett. 12, 1026–1031 (2012).
[Crossref]

M. Liu, X. Yin, and X. Zhang, “Double-layer graphene optical modulator,” Nano Lett. 12, 1482–1485 (2012).
[Crossref]

M. C. Saldías, F. V. Sassarini, C. M. Poblete, A. V. Vásquez, and I. M. Butler, “Image correlation method for DNA sequence alignment,” PloS One 7, e39221 (2012).
[Crossref]

2011 (1)

V. O. Polyanovsky, M. A. Roytberg, and V. G. Tumanyan, “Comparative analysis of the quality of a global algorithm and a local algorithm for alignment of two sequences,” Algorithms Mol. Biol. 6, 25 (2011).
[Crossref]

2010 (1)

X. Tang, P. Zhou, and W. Qiu, “On the similarity/dissimilarity of DNA sequences based on 4D graphical representation,” Chin. Sci. Bull. 55(8), 701–704 (2010).
[Crossref]

2009 (2)

Z.-J. Zhang, “Dv-curve: a novel intuitive tool for visualizing and analyzing DNA sequences,” Bioinformatics 25, 1112–1117 (2009).
[Crossref]

Y. Takaki and N. Okada, “Hologram generation by horizontal scanning of a high-speed spatial light modulator,” Appl. Opt. 48, 3255–3260 (2009).
[Crossref]

2007 (1)

D. W. Mount, “Using the Basic Local Alignment Search Tool (BLAST),” Cold Spring Harbor Protoc. 2007, pdb.top17 (2007).
[Crossref]

2006 (1)

E. Pop, S. Sinha, and K. E. Goodson, “Heat generation and transport in nanometer-scale transistors,” Proc. IEEE 94, 1587–1601 (2006).
[Crossref]

2005 (1)

R. W. Taylor and D. M. Turnbull, “Mitochondrial DNA mutations in human disease,” Nat. Rev. Genet. 6, 389–402 (2005).
[Crossref]

2004 (2)

R. C. Edgar, “Muscle: multiple sequence alignment with high accuracy and high throughput,” Nucleic Acids Res. 32, 1792–1797 (2004).
[Crossref]

B. Liao and T.-M. Wang, “New 2D graphical representation of DNA sequences,” J. Comput. Chem. 25, 1364–1368 (2004).
[Crossref]

2003 (4)

C. Yuan, B. Liao, and T.-M. Wang, “New 3D graphical representation of DNA sequences and their numerical characterization,” Chem. Phys. Lett. 379, 412–417 (2003).
[Crossref]

L. Wouters, H. W. Göhlmann, L. Bijnens, S. U. Kass, G. Molenberghs, and P. J. Lewi, “Graphical exploration of gene expression data: a comparative study of three multivariate methods,” Biometrics 59, 1131–1139 (2003).
[Crossref]

M. Randić, M. Vračko, N. Lerš, and D. Plavšić, “Analysis of similarity/dissimilarity of DNA sequences based on novel 2-D graphical representation,” Chem. Phys. Lett. 371, 202–207 (2003).
[Crossref]

N. G. Smith and A. Eyre-Walker, “Human disease genes: patterns and predictions,” Gene 318, 169–175 (2003).
[Crossref]

2002 (1)

Akhter, S.

S. Akhter and J. Roberts, Multi-Core Programming (Intel, 2006), Vol. 33.

Alqallaf, A.

A. Alqallaf and A. Cherri, “DNA sequencing using optical joint Fourier transform,” Optik 127, 1929–1936 (2016).
[Crossref]

Andryieuski, A.

Anzagira, L.

Armour, F.

S. Kaisler, F. Armour, J. A. Espinosa, and W. Money, “Big data: issues and challenges moving forward,” in 46th Hawaii International Conference on System Sciences (HICSS) (IEEE, 2013), pp. 995–1004.

Au, K. F.

A. Rhoads and K. F. Au, “PacBio sequencing and its applications,” Genomics, Proteomics Bioinf. 13, 278–289 (2015).
[Crossref]

Babashah, H.

F. Mozafari, H. Babashah, S. Koohi, and Z. Kavehvash, “Speeding up DNA sequence alignment by optical correlator,” Opt. Laser Technol. 108, 124–135 (2018).
[Crossref]

E. Maleki, H. Babashah, S. Koohi, and Z. Kavehvash, “High-speed all-optical DNA local sequence alignment based on a three-dimensional artificial neural network,” J. Opt. Soc. Am. A 34, 1173–1186 (2017).
[Crossref]

Baxevanis, A. D.

A. D. Baxevanis and B. F. Ouellette, Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Vol. 43 of Methods of Biochemical Analysis (Wiley, 2004).

Bellman, R.

R. Bellman, Dynamic Programming (Courier, 2013).

Bellman, R. E.

R. E. Bellman and S. E. Dreyfus, Applied Dynamic Programming (Princeton University, 2015).

Berk, A.

C. A. Kaiser, M. Krieger, H. Lodish, and A. Berk, Molecular Cell Biology (WH Freeman, 2007).

Bijnens, L.

L. Wouters, H. W. Göhlmann, L. Bijnens, S. U. Kass, G. Molenberghs, and P. J. Lewi, “Graphical exploration of gene expression data: a comparative study of three multivariate methods,” Biometrics 59, 1131–1139 (2003).
[Crossref]

Blaabjerg, F.

M. P. Kaźmierkowski, R. Krishnan, and F. Blaabjerg, Control in Power Electronics: Selected Problems (Academic, 2002).

Bokor, J.

Butler, I. M.

M. C. Saldías, F. V. Sassarini, C. M. Poblete, A. V. Vásquez, and I. M. Butler, “Image correlation method for DNA sequence alignment,” PloS One 7, e39221 (2012).
[Crossref]

Cherri, A.

A. Alqallaf and A. Cherri, “DNA sequencing using optical joint Fourier transform,” Optik 127, 1929–1936 (2016).
[Crossref]

Chipman, R.

Crozier, K. B.

T. Ellenbogen, K. Seo, and K. B. Crozier, “Chromatic plasmonic polarizers for active visible color filtering and polarimetry,” Nano Lett. 12, 1026–1031 (2012).
[Crossref]

Davis, J.

DeVore, P. T.

Dreyfus, S. E.

R. E. Bellman and S. E. Dreyfus, Applied Dynamic Programming (Princeton University, 2015).

Edgar, R. C.

R. C. Edgar, “Muscle: multiple sequence alignment with high accuracy and high throughput,” Nucleic Acids Res. 32, 1792–1797 (2004).
[Crossref]

Ellenbogen, T.

T. Ellenbogen, K. Seo, and K. B. Crozier, “Chromatic plasmonic polarizers for active visible color filtering and polarimetry,” Nano Lett. 12, 1026–1031 (2012).
[Crossref]

Espinosa, J. A.

S. Kaisler, F. Armour, J. A. Espinosa, and W. Money, “Big data: issues and challenges moving forward,” in 46th Hawaii International Conference on System Sciences (HICSS) (IEEE, 2013), pp. 995–1004.

Eyre-Walker, A.

N. G. Smith and A. Eyre-Walker, “Human disease genes: patterns and predictions,” Gene 318, 169–175 (2003).
[Crossref]

Fan, X.

Y. Sun and X. Fan, “Optofluidic lasers for DNA mutation detection,” in Laser Science (Optical Society of America, 2012), paper LTh4F-1.

Fossum, E. R.

Giegerich, R.

R. Giegerich and D. Wheeler, “Pairwise sequence alignment,” (VCNS Biocomputing Division, University of Bielefeld, 1996).

Göhlmann, H. W.

L. Wouters, H. W. Göhlmann, L. Bijnens, S. U. Kass, G. Molenberghs, and P. J. Lewi, “Graphical exploration of gene expression data: a comparative study of three multivariate methods,” Biometrics 59, 1131–1139 (2003).
[Crossref]

Goldberg, K. A.

Goodson, K. E.

E. Pop, S. Sinha, and K. E. Goodson, “Heat generation and transport in nanometer-scale transistors,” Proc. IEEE 94, 1587–1601 (2006).
[Crossref]

Grama, A.

A. Grama, Introduction to Parallel Computing (Pearson Education, 2003).

Griffiths, A. J.

A. J. Griffiths, An Introduction to Genetic Analysis (Macmillan, 2005).

Hsu, W.-L.

Hunt, J.

C. M. Watts, D. Shrekenhamer, J. Montoya, G. Lipworth, J. Hunt, T. Sleasman, S. Krishna, D. R. Smith, and W. J. Padilla, “Terahertz compressive imaging with metamaterial spatial light modulators,” Nat. Photonics 8, 605–609 (2014).
[Crossref]

Iranmanesh, A.

N. Jafarzadeh and A. Iranmanesh, “C-curve: a novel 3D graphical representation of DNA sequence based on codons,” Math. Biosci. 241, 217–224 (2013).
[Crossref]

Jafarzadeh, N.

N. Jafarzadeh and A. Iranmanesh, “C-curve: a novel 3D graphical representation of DNA sequence based on codons,” Math. Biosci. 241, 217–224 (2013).
[Crossref]

Jalali, B.

Jiang, Y.

Kaiser, C. A.

C. A. Kaiser, M. Krieger, H. Lodish, and A. Berk, Molecular Cell Biology (WH Freeman, 2007).

Kaisler, S.

S. Kaisler, F. Armour, J. A. Espinosa, and W. Money, “Big data: issues and challenges moving forward,” in 46th Hawaii International Conference on System Sciences (HICSS) (IEEE, 2013), pp. 995–1004.

Kass, S. U.

L. Wouters, H. W. Göhlmann, L. Bijnens, S. U. Kass, G. Molenberghs, and P. J. Lewi, “Graphical exploration of gene expression data: a comparative study of three multivariate methods,” Biometrics 59, 1131–1139 (2003).
[Crossref]

Kavehvash, Z.

F. Mozafari, H. Babashah, S. Koohi, and Z. Kavehvash, “Speeding up DNA sequence alignment by optical correlator,” Opt. Laser Technol. 108, 124–135 (2018).
[Crossref]

E. Maleki, H. Babashah, S. Koohi, and Z. Kavehvash, “High-speed all-optical DNA local sequence alignment based on a three-dimensional artificial neural network,” J. Opt. Soc. Am. A 34, 1173–1186 (2017).
[Crossref]

Kazmierkowski, M. P.

M. P. Kaźmierkowski, R. Krishnan, and F. Blaabjerg, Control in Power Electronics: Selected Problems (Academic, 2002).

Koohi, S.

F. Mozafari, H. Babashah, S. Koohi, and Z. Kavehvash, “Speeding up DNA sequence alignment by optical correlator,” Opt. Laser Technol. 108, 124–135 (2018).
[Crossref]

E. Maleki, H. Babashah, S. Koohi, and Z. Kavehvash, “High-speed all-optical DNA local sequence alignment based on a three-dimensional artificial neural network,” J. Opt. Soc. Am. A 34, 1173–1186 (2017).
[Crossref]

Krieger, M.

C. A. Kaiser, M. Krieger, H. Lodish, and A. Berk, Molecular Cell Biology (WH Freeman, 2007).

Krishna, S.

C. M. Watts, D. Shrekenhamer, J. Montoya, G. Lipworth, J. Hunt, T. Sleasman, S. Krishna, D. R. Smith, and W. J. Padilla, “Terahertz compressive imaging with metamaterial spatial light modulators,” Nat. Photonics 8, 605–609 (2014).
[Crossref]

Krishnan, R.

M. P. Kaźmierkowski, R. Krishnan, and F. Blaabjerg, Control in Power Electronics: Selected Problems (Academic, 2002).

Lavrinenko, A. V.

Lerš, N.

M. Randić, M. Vračko, N. Lerš, and D. Plavšić, “Analysis of similarity/dissimilarity of DNA sequences based on novel 2-D graphical representation,” Chem. Phys. Lett. 371, 202–207 (2003).
[Crossref]

Lesk, A.

A. Lesk, Introduction to Bioinformatics (Oxford University, 2013).

Lewi, P. J.

L. Wouters, H. W. Göhlmann, L. Bijnens, S. U. Kass, G. Molenberghs, and P. J. Lewi, “Graphical exploration of gene expression data: a comparative study of three multivariate methods,” Biometrics 59, 1131–1139 (2003).
[Crossref]

Liao, B.

B. Liao and T.-M. Wang, “New 2D graphical representation of DNA sequences,” J. Comput. Chem. 25, 1364–1368 (2004).
[Crossref]

C. Yuan, B. Liao, and T.-M. Wang, “New 3D graphical representation of DNA sequences and their numerical characterization,” Chem. Phys. Lett. 379, 412–417 (2003).
[Crossref]

Likic, V.

V. Likic, “The Needleman-Wunsch algorithm for sequence alignment,” in 7th Melbourne Bioinformatics Course (Bi021 Molecular Science and Biotechnology Institute, University of Melbourne, 2008), pp. 1–46.

Lipworth, G.

C. M. Watts, D. Shrekenhamer, J. Montoya, G. Lipworth, J. Hunt, T. Sleasman, S. Krishna, D. R. Smith, and W. J. Padilla, “Terahertz compressive imaging with metamaterial spatial light modulators,” Nat. Photonics 8, 605–609 (2014).
[Crossref]

Liu, M.

M. Liu, X. Yin, and X. Zhang, “Double-layer graphene optical modulator,” Nano Lett. 12, 1482–1485 (2012).
[Crossref]

Lodish, H.

C. A. Kaiser, M. Krieger, H. Lodish, and A. Berk, Molecular Cell Biology (WH Freeman, 2007).

Mairiang, D.

W. Pinthong, P. Muangruen, P. Suriyaphol, and D. Mairiang, “A simple grid implementation with Berkeley open infrastructure for network computing using blast as a model,” PeerJ 4, e2248 (2016).
[Crossref]

Maleki, E.

Molenberghs, G.

L. Wouters, H. W. Göhlmann, L. Bijnens, S. U. Kass, G. Molenberghs, and P. J. Lewi, “Graphical exploration of gene expression data: a comparative study of three multivariate methods,” Biometrics 59, 1131–1139 (2003).
[Crossref]

Money, W.

S. Kaisler, F. Armour, J. A. Espinosa, and W. Money, “Big data: issues and challenges moving forward,” in 46th Hawaii International Conference on System Sciences (HICSS) (IEEE, 2013), pp. 995–1004.

Montoya, J.

C. M. Watts, D. Shrekenhamer, J. Montoya, G. Lipworth, J. Hunt, T. Sleasman, S. Krishna, D. R. Smith, and W. J. Padilla, “Terahertz compressive imaging with metamaterial spatial light modulators,” Nat. Photonics 8, 605–609 (2014).
[Crossref]

Mott, R.

R. Mott, Smith–Waterman Algorithm (eLS, 2005).

Mount, D. W.

D. W. Mount, “Using the Basic Local Alignment Search Tool (BLAST),” Cold Spring Harbor Protoc. 2007, pdb.top17 (2007).
[Crossref]

Mozafari, F.

F. Mozafari, H. Babashah, S. Koohi, and Z. Kavehvash, “Speeding up DNA sequence alignment by optical correlator,” Opt. Laser Technol. 108, 124–135 (2018).
[Crossref]

Muangruen, P.

W. Pinthong, P. Muangruen, P. Suriyaphol, and D. Mairiang, “A simple grid implementation with Berkeley open infrastructure for network computing using blast as a model,” PeerJ 4, e2248 (2016).
[Crossref]

Naulleau, P.

Okada, N.

Ouellette, B. F.

A. D. Baxevanis and B. F. Ouellette, Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Vol. 43 of Methods of Biochemical Analysis (Wiley, 2004).

Padilla, W. J.

C. M. Watts, D. Shrekenhamer, J. Montoya, G. Lipworth, J. Hunt, T. Sleasman, S. Krishna, D. R. Smith, and W. J. Padilla, “Terahertz compressive imaging with metamaterial spatial light modulators,” Nat. Photonics 8, 605–609 (2014).
[Crossref]

Pau, S.

Pinthong, W.

W. Pinthong, P. Muangruen, P. Suriyaphol, and D. Mairiang, “A simple grid implementation with Berkeley open infrastructure for network computing using blast as a model,” PeerJ 4, e2248 (2016).
[Crossref]

Plataniotis, K.

K. Plataniotis and A. N. Venetsanopoulos, Color Image Processing and Applications (Springer, 2013).

Plavšic, D.

M. Randić, M. Vračko, N. Lerš, and D. Plavšić, “Analysis of similarity/dissimilarity of DNA sequences based on novel 2-D graphical representation,” Chem. Phys. Lett. 371, 202–207 (2003).
[Crossref]

Poblete, C. M.

M. C. Saldías, F. V. Sassarini, C. M. Poblete, A. V. Vásquez, and I. M. Butler, “Image correlation method for DNA sequence alignment,” PloS One 7, e39221 (2012).
[Crossref]

Polyanovsky, V. O.

V. O. Polyanovsky, M. A. Roytberg, and V. G. Tumanyan, “Comparative analysis of the quality of a global algorithm and a local algorithm for alignment of two sequences,” Algorithms Mol. Biol. 6, 25 (2011).
[Crossref]

Pop, E.

E. Pop, S. Sinha, and K. E. Goodson, “Heat generation and transport in nanometer-scale transistors,” Proc. IEEE 94, 1587–1601 (2006).
[Crossref]

Qiu, W.

X. Tang, P. Zhou, and W. Qiu, “On the similarity/dissimilarity of DNA sequences based on 4D graphical representation,” Chin. Sci. Bull. 55(8), 701–704 (2010).
[Crossref]

Randic, M.

M. Randić, M. Vračko, N. Lerš, and D. Plavšić, “Analysis of similarity/dissimilarity of DNA sequences based on novel 2-D graphical representation,” Chem. Phys. Lett. 371, 202–207 (2003).
[Crossref]

Rhoads, A.

A. Rhoads and K. F. Au, “PacBio sequencing and its applications,” Genomics, Proteomics Bioinf. 13, 278–289 (2015).
[Crossref]

Roberts, J.

S. Akhter and J. Roberts, Multi-Core Programming (Intel, 2006), Vol. 33.

Roytberg, M. A.

V. O. Polyanovsky, M. A. Roytberg, and V. G. Tumanyan, “Comparative analysis of the quality of a global algorithm and a local algorithm for alignment of two sequences,” Algorithms Mol. Biol. 6, 25 (2011).
[Crossref]

Saldías, M. C.

M. C. Saldías, F. V. Sassarini, C. M. Poblete, A. V. Vásquez, and I. M. Butler, “Image correlation method for DNA sequence alignment,” PloS One 7, e39221 (2012).
[Crossref]

Sassarini, F. V.

M. C. Saldías, F. V. Sassarini, C. M. Poblete, A. V. Vásquez, and I. M. Butler, “Image correlation method for DNA sequence alignment,” PloS One 7, e39221 (2012).
[Crossref]

Seo, K.

T. Ellenbogen, K. Seo, and K. B. Crozier, “Chromatic plasmonic polarizers for active visible color filtering and polarimetry,” Nano Lett. 12, 1026–1031 (2012).
[Crossref]

Shrekenhamer, D.

C. M. Watts, D. Shrekenhamer, J. Montoya, G. Lipworth, J. Hunt, T. Sleasman, S. Krishna, D. R. Smith, and W. J. Padilla, “Terahertz compressive imaging with metamaterial spatial light modulators,” Nat. Photonics 8, 605–609 (2014).
[Crossref]

Sinha, S.

E. Pop, S. Sinha, and K. E. Goodson, “Heat generation and transport in nanometer-scale transistors,” Proc. IEEE 94, 1587–1601 (2006).
[Crossref]

Sleasman, T.

C. M. Watts, D. Shrekenhamer, J. Montoya, G. Lipworth, J. Hunt, T. Sleasman, S. Krishna, D. R. Smith, and W. J. Padilla, “Terahertz compressive imaging with metamaterial spatial light modulators,” Nat. Photonics 8, 605–609 (2014).
[Crossref]

Smith, D. R.

C. M. Watts, D. Shrekenhamer, J. Montoya, G. Lipworth, J. Hunt, T. Sleasman, S. Krishna, D. R. Smith, and W. J. Padilla, “Terahertz compressive imaging with metamaterial spatial light modulators,” Nat. Photonics 8, 605–609 (2014).
[Crossref]

Smith, N. G.

N. G. Smith and A. Eyre-Walker, “Human disease genes: patterns and predictions,” Gene 318, 169–175 (2003).
[Crossref]

Sun, Y.

Y. Sun and X. Fan, “Optofluidic lasers for DNA mutation detection,” in Laser Science (Optical Society of America, 2012), paper LTh4F-1.

Suriyaphol, P.

W. Pinthong, P. Muangruen, P. Suriyaphol, and D. Mairiang, “A simple grid implementation with Berkeley open infrastructure for network computing using blast as a model,” PeerJ 4, e2248 (2016).
[Crossref]

Takaki, Y.

Tang, X.

X. Tang, P. Zhou, and W. Qiu, “On the similarity/dissimilarity of DNA sequences based on 4D graphical representation,” Chin. Sci. Bull. 55(8), 701–704 (2010).
[Crossref]

Taylor, R. W.

R. W. Taylor and D. M. Turnbull, “Mitochondrial DNA mutations in human disease,” Nat. Rev. Genet. 6, 389–402 (2005).
[Crossref]

Tumanyan, V. G.

V. O. Polyanovsky, M. A. Roytberg, and V. G. Tumanyan, “Comparative analysis of the quality of a global algorithm and a local algorithm for alignment of two sequences,” Algorithms Mol. Biol. 6, 25 (2011).
[Crossref]

Turnbull, D. M.

R. W. Taylor and D. M. Turnbull, “Mitochondrial DNA mutations in human disease,” Nat. Rev. Genet. 6, 389–402 (2005).
[Crossref]

Vásquez, A. V.

M. C. Saldías, F. V. Sassarini, C. M. Poblete, A. V. Vásquez, and I. M. Butler, “Image correlation method for DNA sequence alignment,” PloS One 7, e39221 (2012).
[Crossref]

Venetsanopoulos, A. N.

K. Plataniotis and A. N. Venetsanopoulos, Color Image Processing and Applications (Springer, 2013).

Vracko, M.

M. Randić, M. Vračko, N. Lerš, and D. Plavšić, “Analysis of similarity/dissimilarity of DNA sequences based on novel 2-D graphical representation,” Chem. Phys. Lett. 371, 202–207 (2003).
[Crossref]

Wang, T.-M.

B. Liao and T.-M. Wang, “New 2D graphical representation of DNA sequences,” J. Comput. Chem. 25, 1364–1368 (2004).
[Crossref]

C. Yuan, B. Liao, and T.-M. Wang, “New 3D graphical representation of DNA sequences and their numerical characterization,” Chem. Phys. Lett. 379, 412–417 (2003).
[Crossref]

Watts, C. M.

C. M. Watts, D. Shrekenhamer, J. Montoya, G. Lipworth, J. Hunt, T. Sleasman, S. Krishna, D. R. Smith, and W. J. Padilla, “Terahertz compressive imaging with metamaterial spatial light modulators,” Nat. Photonics 8, 605–609 (2014).
[Crossref]

Wheeler, D.

R. Giegerich and D. Wheeler, “Pairwise sequence alignment,” (VCNS Biocomputing Division, University of Bielefeld, 1996).

Wouters, L.

L. Wouters, H. W. Göhlmann, L. Bijnens, S. U. Kass, G. Molenberghs, and P. J. Lewi, “Graphical exploration of gene expression data: a comparative study of three multivariate methods,” Biometrics 59, 1131–1139 (2003).
[Crossref]

Yin, X.

M. Liu, X. Yin, and X. Zhang, “Double-layer graphene optical modulator,” Nano Lett. 12, 1482–1485 (2012).
[Crossref]

Yuan, C.

C. Yuan, B. Liao, and T.-M. Wang, “New 3D graphical representation of DNA sequences and their numerical characterization,” Chem. Phys. Lett. 379, 412–417 (2003).
[Crossref]

Zhang, X.

M. Liu, X. Yin, and X. Zhang, “Double-layer graphene optical modulator,” Nano Lett. 12, 1482–1485 (2012).
[Crossref]

Zhang, Z.-J.

Z.-J. Zhang, “Dv-curve: a novel intuitive tool for visualizing and analyzing DNA sequences,” Bioinformatics 25, 1112–1117 (2009).
[Crossref]

Zhou, P.

X. Tang, P. Zhou, and W. Qiu, “On the similarity/dissimilarity of DNA sequences based on 4D graphical representation,” Chin. Sci. Bull. 55(8), 701–704 (2010).
[Crossref]

Algorithms Mol. Biol. (1)

V. O. Polyanovsky, M. A. Roytberg, and V. G. Tumanyan, “Comparative analysis of the quality of a global algorithm and a local algorithm for alignment of two sequences,” Algorithms Mol. Biol. 6, 25 (2011).
[Crossref]

Appl. Opt. (3)

Bioinformatics (1)

Z.-J. Zhang, “Dv-curve: a novel intuitive tool for visualizing and analyzing DNA sequences,” Bioinformatics 25, 1112–1117 (2009).
[Crossref]

Biometrics (1)

L. Wouters, H. W. Göhlmann, L. Bijnens, S. U. Kass, G. Molenberghs, and P. J. Lewi, “Graphical exploration of gene expression data: a comparative study of three multivariate methods,” Biometrics 59, 1131–1139 (2003).
[Crossref]

Chem. Phys. Lett. (2)

M. Randić, M. Vračko, N. Lerš, and D. Plavšić, “Analysis of similarity/dissimilarity of DNA sequences based on novel 2-D graphical representation,” Chem. Phys. Lett. 371, 202–207 (2003).
[Crossref]

C. Yuan, B. Liao, and T.-M. Wang, “New 3D graphical representation of DNA sequences and their numerical characterization,” Chem. Phys. Lett. 379, 412–417 (2003).
[Crossref]

Chin. Sci. Bull. (1)

X. Tang, P. Zhou, and W. Qiu, “On the similarity/dissimilarity of DNA sequences based on 4D graphical representation,” Chin. Sci. Bull. 55(8), 701–704 (2010).
[Crossref]

Cold Spring Harbor Protoc. (1)

D. W. Mount, “Using the Basic Local Alignment Search Tool (BLAST),” Cold Spring Harbor Protoc. 2007, pdb.top17 (2007).
[Crossref]

Gene (1)

N. G. Smith and A. Eyre-Walker, “Human disease genes: patterns and predictions,” Gene 318, 169–175 (2003).
[Crossref]

Genomics, Proteomics Bioinf. (1)

A. Rhoads and K. F. Au, “PacBio sequencing and its applications,” Genomics, Proteomics Bioinf. 13, 278–289 (2015).
[Crossref]

J. Comput. Chem. (1)

B. Liao and T.-M. Wang, “New 2D graphical representation of DNA sequences,” J. Comput. Chem. 25, 1364–1368 (2004).
[Crossref]

J. Opt. Soc. Am. A (2)

Math. Biosci. (1)

N. Jafarzadeh and A. Iranmanesh, “C-curve: a novel 3D graphical representation of DNA sequence based on codons,” Math. Biosci. 241, 217–224 (2013).
[Crossref]

Nano Lett. (2)

T. Ellenbogen, K. Seo, and K. B. Crozier, “Chromatic plasmonic polarizers for active visible color filtering and polarimetry,” Nano Lett. 12, 1026–1031 (2012).
[Crossref]

M. Liu, X. Yin, and X. Zhang, “Double-layer graphene optical modulator,” Nano Lett. 12, 1482–1485 (2012).
[Crossref]

Nat. Photonics (1)

C. M. Watts, D. Shrekenhamer, J. Montoya, G. Lipworth, J. Hunt, T. Sleasman, S. Krishna, D. R. Smith, and W. J. Padilla, “Terahertz compressive imaging with metamaterial spatial light modulators,” Nat. Photonics 8, 605–609 (2014).
[Crossref]

Nat. Rev. Genet. (1)

R. W. Taylor and D. M. Turnbull, “Mitochondrial DNA mutations in human disease,” Nat. Rev. Genet. 6, 389–402 (2005).
[Crossref]

Nucleic Acids Res. (1)

R. C. Edgar, “Muscle: multiple sequence alignment with high accuracy and high throughput,” Nucleic Acids Res. 32, 1792–1797 (2004).
[Crossref]

Opt. Express (1)

Opt. Laser Technol. (1)

F. Mozafari, H. Babashah, S. Koohi, and Z. Kavehvash, “Speeding up DNA sequence alignment by optical correlator,” Opt. Laser Technol. 108, 124–135 (2018).
[Crossref]

Opt. Lett. (1)

Optik (1)

A. Alqallaf and A. Cherri, “DNA sequencing using optical joint Fourier transform,” Optik 127, 1929–1936 (2016).
[Crossref]

PeerJ (1)

W. Pinthong, P. Muangruen, P. Suriyaphol, and D. Mairiang, “A simple grid implementation with Berkeley open infrastructure for network computing using blast as a model,” PeerJ 4, e2248 (2016).
[Crossref]

PloS One (1)

M. C. Saldías, F. V. Sassarini, C. M. Poblete, A. V. Vásquez, and I. M. Butler, “Image correlation method for DNA sequence alignment,” PloS One 7, e39221 (2012).
[Crossref]

Proc. IEEE (1)

E. Pop, S. Sinha, and K. E. Goodson, “Heat generation and transport in nanometer-scale transistors,” Proc. IEEE 94, 1587–1601 (2006).
[Crossref]

Other (15)

Y. Sun and X. Fan, “Optofluidic lasers for DNA mutation detection,” in Laser Science (Optical Society of America, 2012), paper LTh4F-1.

K. Plataniotis and A. N. Venetsanopoulos, Color Image Processing and Applications (Springer, 2013).

C. A. Kaiser, M. Krieger, H. Lodish, and A. Berk, Molecular Cell Biology (WH Freeman, 2007).

R. Giegerich and D. Wheeler, “Pairwise sequence alignment,” (VCNS Biocomputing Division, University of Bielefeld, 1996).

A. Lesk, Introduction to Bioinformatics (Oxford University, 2013).

A. J. Griffiths, An Introduction to Genetic Analysis (Macmillan, 2005).

A. D. Baxevanis and B. F. Ouellette, Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Vol. 43 of Methods of Biochemical Analysis (Wiley, 2004).

V. Likic, “The Needleman-Wunsch algorithm for sequence alignment,” in 7th Melbourne Bioinformatics Course (Bi021 Molecular Science and Biotechnology Institute, University of Melbourne, 2008), pp. 1–46.

S. Kaisler, F. Armour, J. A. Espinosa, and W. Money, “Big data: issues and challenges moving forward,” in 46th Hawaii International Conference on System Sciences (HICSS) (IEEE, 2013), pp. 995–1004.

M. P. Kaźmierkowski, R. Krishnan, and F. Blaabjerg, Control in Power Electronics: Selected Problems (Academic, 2002).

R. Mott, Smith–Waterman Algorithm (eLS, 2005).

R. Bellman, Dynamic Programming (Courier, 2013).

R. E. Bellman and S. E. Dreyfus, Applied Dynamic Programming (Princeton University, 2015).

A. Grama, Introduction to Parallel Computing (Pearson Education, 2003).

S. Akhter and J. Roberts, Multi-Core Programming (Intel, 2006), Vol. 33.

Cited By

OSA participates in Crossref's Cited-By Linking service. Citing articles from OSA journals and other participating publishers are listed here.

Alert me when this article is cited.


Figures (22)

Fig. 1.
Fig. 1. Point mutation types in DNA sequence alignment.
Fig. 2.
Fig. 2. (a) Optical DNA correlation used for global DNA sequence alignment, (b) proposed optical extension of DV-curve method for local DNA sequence alignment.
Fig. 3.
Fig. 3. Global sequence alignment procedure by optical correlation.
Fig. 4.
Fig. 4. Traditional DV-curve coding scheme.
Fig. 5.
Fig. 5. DV-curve of DNA sequence in length (a) 150 base pair and (b) 300 base pair.
Fig. 6.
Fig. 6. Analysis of DV-curve output in the case of single base pair (a) substitution, (b) insertion, and (c) deletion. HM, horizontal movement; VM, vertical movement.
Fig. 7.
Fig. 7. Proposed optical local sequence alignment by the HAWPOD method.
Fig. 8.
Fig. 8. Overlapping traditional DV-curve of DNA sequences.
Fig. 9.
Fig. 9. Horizontal repetition of vertically repeated curves.
Fig. 10.
Fig. 10. Undesired non-zero-pixel in output by repetition of curve of DNA sequence.
Fig. 11.
Fig. 11. HAWPOD scheme for wavelength coding of nucleotides A, T, C, G.
Fig. 12.
Fig. 12. Example of the HAWPOD coding scheme.
Fig. 13.
Fig. 13. Step-by-step outputs in the HAWPOD method.
Fig. 14.
Fig. 14. Explanation of the HAWPOD method output.
Fig. 15.
Fig. 15. Schematic of the proposed tunable graphene-based color filter cell consisting of two layers deposited on a gold nanostructure.
Fig. 16.
Fig. 16. Contour visualization of transmission spectrum of the proposed graphene-based color filter nanoribbon as a function of Fermi level and wavelength.
Fig. 17.
Fig. 17. Plot for demonstrating appropriate free spectral range of transmission spectrum of the proposed graphene-based color filter nanoribbon.
Fig. 18.
Fig. 18. Optical implementation of the HAWPOD method.
Fig. 19.
Fig. 19. Correlation result of reference and query sequences for global alignment.
Fig. 20.
Fig. 20. (a) Input DNA sequences, (b) primary output of HAWPOD alignment phase, (c) elimination of undesired noise, (d) output of simplification phase, and (e) final output of the HAWPOD method.
Fig. 21.
Fig. 21. Traditional DV-curve output.
Fig. 22.
Fig. 22. Computational time of the HAWPOD method for various numbers of inputs.

Tables (1)

Tables Icon

Table 1. Value of k for Various m , n

Equations (4)

Equations on this page are rendered with MathJax. Learn more.

n = X end 2 .
W N i = w N i ( k N i , N i 1 × 0.52 ) ( k N i , N i + 1 × 0.13 ) + ( ( R 1 ) × 0.13 ) ,
AGTTTGGCTCCTGTCAGCCTCCATAAAATCTGGGA CGCCAAGAGCCCCACTGAGAGGTACAGGCTGGCCC TGTCTCGTAATGCATCTCGGTTAGCACAGGGGCTG ATGTGACAGGCTGTAGGTTCCGTAACCCCTGCCAT CTCAAGCATG .
Input DNA subsequence = AGTTTGGCTCCTG G CAGC CTCCATAAAATCTGGGACCCGAGCCCCACTGAGAG GTACAGGCTGG A CC CTGTCTCGTAATGCAGCTCGG TTAGCACAGGGGC AA TGATGTGACAGGCTGTGGTT CCGTAACCTCCTG TAT TCTCAAGCATG , Reference DNA subsequence = AGTTTGGCTCCTG T CA GCCTCCATAAAATCTGGGACCC AA GAGCCCCACTG AGAGGTACAGGCTGGCCCTGTCTCGTAATGCAGC TCGGTTAGCACAGGGGCTGATGTGACAGGCTGT A GGTTCCGTAACCTCCTG CCA TCTCAAGCATG .