Highly sensitive detection of cancer cells using femtosecond dual-wavelength near-IR two-photon imaging

Jean R. Starkey; Nikolay S. Makarov; Mikhail Drobizhev; Aleksander Rebane

doi:10.1364/BOE.3.001534

Highly sensitive detection of cancer cells using femtosecond dual-wavelength near-IR two-photon imaging

Jean R. Starkey, Nikolay S. Makarov, Mikhail Drobizhev, and Aleksander Rebane

Biomedical Optics Express
Vol. 3,
Issue 7,
pp. 1534-1547
(2012)
•https://doi.org/10.1364/BOE.3.001534

Get Citation
Copy Citation Text
Jean R. Starkey, Nikolay S. Makarov, Mikhail Drobizhev, and Aleksander Rebane, "Highly sensitive detection of cancer cells using femtosecond dual-wavelength near-IR two-photon imaging," Biomed. Opt. Express 3, 1534-1547 (2012)

Export Citation
- BibTex
- Endnote (RIS)
- HTML
- Plain Text
Get PDF (1477 KB)
Set citation alerts
Save article

Accessible

Open Access

Abstract

We describe novel imaging protocols that allow detection of small cancer cell colonies deep inside tissue phantoms with high sensitivity and specificity. We compare fluorescence excited in Styryl-9M molecules by femtosecond pulses at near IR wavelengths, where Styryl-9M shows the largest dependence of the two-photon absorption (2PA) cross section on the local environment. We show that by calculating the normalized ratio of the two-photon excited fluorescence (2PEF) intensity at 1200 nm and 1100 nm excitation wavelengths we can achieve high sensitivity and specificity for determining the location of cancer cells surrounded by normal cells. The 2PEF results showed a positive correlation with the levels of MDR1 proteins expressed by the cells, and, for high MDR1 expressors, as few as ten cancer cells could be detected. Similar high sensitivity is also demonstrated for tumor colonies induced in mouse external ears. This technique could be useful in early cancer detection, and, perhaps, also in monitoring dormant cancer deposits.

Full Article | PDF Article

References

View by:
Article Order
|
Year
|
Author
|
Publication

M. Solomon, Y. Liu, M. Y. Berezin, and S. Achilefu, “Optical imaging in cancer research: basic principles, tumor detection, and therapeutic monitoring,” Med. Princ. Pract. 20(5), 397–415 (2011).
[Crossref] [PubMed]
J. M. Song, R. Jagannathan, D. L. Stokes, P. M. Kasili, M. Panjehpour, M. N. Phan, B. F. Overholt, R. C. DeNovo, X. Pan, R. J. Lee, and T. Vo-Dinh, “Development of a fluorescence detection system using optical parametric oscillator (OPO) laser excitation for in vivo diagnosis,” Technol. Cancer Res. Treat. 2(6), 515–523 (2003).
[PubMed]
P. S. Adusumilli, D. P. Eisenberg, Y. S. Chun, K. W. Ryu, L. Ben-Porat, K. J. Hendershott, M. K. Chan, R. Huq, C. C. Riedl, and Y. Fong, “Virally directed fluorescent imaging improves diagnostic sensitivity in the detection of minimal residual disease after potentially curative cytoreductive surgery,” J. Gastrointest. Surg. 9(8), 1138–1147 (2005).
[Crossref] [PubMed]
M. T. Weigel and M. Dowsett, “Current and emerging biomarkers in breast cancer: prognosis and prediction,” Endocr. Relat. Cancer 17(4), R245–R262 (2010).
[Crossref] [PubMed]
K. Licha, C. Hessenius, A. Becker, P. Henklein, M. Bauer, S. Wisniewski, B. Wiedenmann, and W. Semmler, “Synthesis, characterization, and biological properties of cyanine-labeled somatostatin analogues as receptor-targeted fluorescent probes,” Bioconjug. Chem. 12(1), 44–50 (2001).
[Crossref] [PubMed]
S. Achilefu, “Lighting up tumors with receptor-specific optical molecular probes,” Technol. Cancer Res. Treat. 3(4), 393–409 (2004).
[PubMed]
S. Kukreti, A. E. Cerussi, W. Tanamai, D. Hsiang, B. J. Tromberg, and E. Gratton, “Characterization of metabolic differences between benign and malignant tumors: high-spectral-resolution diffuse optical spectroscopy,” Radiology 254(1), 277–284 (2010).
[Crossref] [PubMed]
J. E. Bugaj, S. Achilefu, R. B. Dorshow, and R. Rajagopalan, “Novel fluorescent contrast agents for optical imaging of in vivo tumors based on a receptor-targeted dye-peptide conjugate platform,” J. Biomed. Opt. 6(2), 122–133 (2001).
[Crossref] [PubMed]
S. Achilefu, R. B. Dorshow, J. E. Bugaj, and R. Rajagopalan, “Novel receptor-targeted fluorescent contrast agents for in vivo tumor imaging,” Invest. Radiol. 35(8), 479–485 (2000).
[Crossref] [PubMed]
L. Josephson, M. F. Kircher, U. Mahmood, Y. Tang, and R. Weissleder, “Near-infrared fluorescent nanoparticles as combined MR/optical imaging probes,” Bioconjug. Chem. 13(3), 554–560 (2002).
[Crossref] [PubMed]
F. B. Haeussinger, S. Heinzel, T. Hahn, M. Schecklmann, A. C. Ehlis, and A. J. Fallgatter, “Simulation of near-infrared light absorption considering individual head and prefrontal cortex anatomy: implications for optical neuroimaging,” PLoS ONE 6(10), e26377 (2011).
[Crossref] [PubMed]
C. G. Hadjipanayis, H. Jiang, D. W. Roberts, and L. Yang, “Current and future clinical applications for optical imaging of cancer: from intraoperative surgical guidance to cancer screening,” Semin. Oncol. 38(1), 109–118 (2011).
[Crossref] [PubMed]
N. Almog, “Molecular mechanisms underlying tumor dormancy,” Cancer Lett. 294(2), 139–146 (2010).
[Crossref] [PubMed]
O. A. Oredipe, R. F. Barth, S. E. Tuttle, D. M. Adams, I. Sautins, D. M. Bucci, C. M. Mojzisik, G. H. Hinkle, S. Jewell, Z. Steplewski, M. O. Thurston, and E. W. Martin, “Limits of sensitivity for the radioimmunodetection of colon cancer by means of a hand held gamma probe” Int. J. Rad. Appl. Instrum. Part B. Nucl. Med. Biol. 15, 595–603 (1988).
P. O. Brown and C. Palmer, “The preclinical natural history of serous ovarian cancer: defining the target for early detection,” PLoS Med. 6(7), e1000114 (2009).
[Crossref] [PubMed]
H. Hayashi, K. Ashizawa, M. Uetani, S. Futagawa, A. Fukushima, K. Minami, S. Honda, and K. Hayashi, “Detectability of peripheral lung cancer on chest radiographs: effect of the size, location and extent of ground-glass opacity,” Br. J. Radiol. 82(976), 272–278 (2009).
[Crossref] [PubMed]
A. Bozzini, G. Renne, L. Meneghetti, G. Bandi, G. Santos, A. R. Vento, S. Menna, S. Andrighetto, G. Viale, E. Cassano, and M. Bellomi, “Sensitivity of imaging for multifocal-multicentric breast carcinoma,” BMC Cancer 8(1), 275 (2008).
[Crossref] [PubMed]
M. Mancini, E. Vergara, G. Salvatore, A. Greco, G. Troncone, A. Affuso, R. Liuzzi, P. Salerno, M. Scotto di Santolo, M. Santoro, A. Brunetti, and M. Salvatore, “Morphological ultrasound microimaging of thyroid in living mice,” Endocrinology 150(10), 4810–4815 (2009).
[Crossref] [PubMed]
N. A. Shkumat, A. Springer, C. M. Walker, E. M. Rohren, W. T. Yang, B. E. Adrada, E. Arribas, S. Carkaci, H. H. Chuang, L. Santiago, and O. R. Mawlawi, “Investigating the limit of detectability of a positron emission mammography device: a phantom study,” Med. Phys. 38(9), 5176–5185 (2011).
[Crossref] [PubMed]
C. Tang, P. J. Russell, R. Martiniello-Wilks, J. E. Rasko, and A. Khatri, “Concise review: Nanoparticles and cellular carriers-allies in cancer imaging and cellular gene therapy?” Stem Cells 28(9), 1686–1702 (2010).
[Crossref] [PubMed]
N. S. Makarov, M. Drobizhev, and A. Rebane, “Two-photon absorption standards in the 550-1600 nm excitation wavelength range,” Opt. Express 16(6), 4029–4047 (2008).
[Crossref] [PubMed]
N. S. Makarov, E. Beuerman, M. Drobizhev, J. Starkey, and A. Rebane, “Environment-sensitive two-photon dye,” Proc. SPIE 7049, 70490Y (2008).
[Crossref]
A. Rebane, M. A. Drobizhev, N. S. Makarov, E. Beuerman, C. Nacke, and J. Pahapill, “Modeling non-Lorentzian two-photon absprption line shape in dipolar chromophores,” J. Lumin. 130(6), 1055–1059 (2010).
[Crossref]
V. P. Tokar, M. Y. Losytskyy, V. B. Kovalska, D. V. Kryvorotenko, A. O. Balanda, V. M. Prokopets, M. P. Galak, I. M. Dmytruk, V. M. Yashchuk, and S. M. Yarmoluk, “Fluorescence of styryl dyes-DNA complexes induced by single- and two-photon excitation,” J. Fluoresc. 16(6), 783–791 (2006).
[Crossref] [PubMed]
R. Ramadass and J. Bereiter-Hahn, ““Photophysical properties of DASPMI as revealed by spectrally resolved fluorescence decays,” J. Phys. B 111(26), 7681–7690 (2007).
[Crossref]
R. B. Owens, H. S. Smith, and A. J. Hackett, “Epithelial cell cultures from normal glandular tissue of mice,” J. Natl. Cancer Inst. 53(1), 261–269 (1974).
[PubMed]
K. G. Danielson, L. W. Anderson, and H. L. Hosick, “Selection and characterization in culture of mammary tumor cells with distinctive growth properties in vivo,” Cancer Res. 40(6), 1812–1819 (1980).
[PubMed]
L. W. Anderson, K. G. Danielson, and H. L. Hosick, “Metastatic potential of hyperplastic alveolar nodule derived mouse mammary tumor cells following intravenous inoculation,” Eur. J. Cancer Clin. Oncol. 17(9), 1001–1008 (1981).
[Crossref] [PubMed]
S. L. Schor, “Cell proliferation and migration on collagen substrata in vitro,” J. Cell Sci. 41, 159–175 (1980).
[PubMed]
H. Birkedal-Hansen and K. Danø, “A sensitive collagenase assay using [3H] collagen labeled by reaction with pyridoxal phosphate and [3H] borohydride,” Anal. Biochem. 115(1), 18–26 (1981).
[Crossref] [PubMed]
R. C. Hallowes, E. S. Bone, and W. Jones, “A new dimension in the culture of human breast,” in Tissue Culture in Medical Research II, R. J. Richards and K. T. Rajan, eds. (Pergamon, Oxford, 1980), pp. 213-220.
N. P. Robertson, J. R. Starkey, S. Hamner, and G. G. Meadows, “Tumor cell invasion of three-dimensional matrices of defined composition: evidence for a specific role for heparan sulfate in rodent cell lines,” Cancer Res. 49(7), 1816–1823 (1989).
[PubMed]
W. Jones and H. L. Hosick, “Collagen concentration as a significant variable for growth and morphology of mouse mammary parenchyma in collagen matrix culture,” Cell Biol. Int. Rep. 10(4), 277–286 (1986).
[Crossref] [PubMed]
M. R. Lugo and F. J. Sharom, “Interaction of LDS-751 with P-glycoprotein and mapping of the location of the R drug binding site,” Biochemistry 44(2), 643–655 (2005).
[Crossref] [PubMed]
“Primer3,” http://frodo.wi.mit.edu/primer3/input.htm .
“ImageJ,” http://rsbweb.nih.gov/ij/
C. D. M. Fletcher, ed., Diagnostic Histopathology of Tumors (Churchill Livingstone, 2007).
P. D. Eckford and F. J. Sharom, “P-glycoprotein (ABCB1) interacts directly with lipid-based anti-cancer drugs and platelet-activating factors,” Biochem. Cell Biol. 84(6), 1022–1033 (2006).
[Crossref] [PubMed]

2011 (4)

M. Solomon, Y. Liu, M. Y. Berezin, and S. Achilefu, “Optical imaging in cancer research: basic principles, tumor detection, and therapeutic monitoring,” Med. Princ. Pract. 20(5), 397–415 (2011).
[Crossref] [PubMed]

F. B. Haeussinger, S. Heinzel, T. Hahn, M. Schecklmann, A. C. Ehlis, and A. J. Fallgatter, “Simulation of near-infrared light absorption considering individual head and prefrontal cortex anatomy: implications for optical neuroimaging,” PLoS ONE 6(10), e26377 (2011).
[Crossref] [PubMed]

C. G. Hadjipanayis, H. Jiang, D. W. Roberts, and L. Yang, “Current and future clinical applications for optical imaging of cancer: from intraoperative surgical guidance to cancer screening,” Semin. Oncol. 38(1), 109–118 (2011).
[Crossref] [PubMed]

N. A. Shkumat, A. Springer, C. M. Walker, E. M. Rohren, W. T. Yang, B. E. Adrada, E. Arribas, S. Carkaci, H. H. Chuang, L. Santiago, and O. R. Mawlawi, “Investigating the limit of detectability of a positron emission mammography device: a phantom study,” Med. Phys. 38(9), 5176–5185 (2011).
[Crossref] [PubMed]

2010 (5)

C. Tang, P. J. Russell, R. Martiniello-Wilks, J. E. Rasko, and A. Khatri, “Concise review: Nanoparticles and cellular carriers-allies in cancer imaging and cellular gene therapy?” Stem Cells 28(9), 1686–1702 (2010).
[Crossref] [PubMed]

A. Rebane, M. A. Drobizhev, N. S. Makarov, E. Beuerman, C. Nacke, and J. Pahapill, “Modeling non-Lorentzian two-photon absprption line shape in dipolar chromophores,” J. Lumin. 130(6), 1055–1059 (2010).
[Crossref]

N. Almog, “Molecular mechanisms underlying tumor dormancy,” Cancer Lett. 294(2), 139–146 (2010).
[Crossref] [PubMed]

M. T. Weigel and M. Dowsett, “Current and emerging biomarkers in breast cancer: prognosis and prediction,” Endocr. Relat. Cancer 17(4), R245–R262 (2010).
[Crossref] [PubMed]

S. Kukreti, A. E. Cerussi, W. Tanamai, D. Hsiang, B. J. Tromberg, and E. Gratton, “Characterization of metabolic differences between benign and malignant tumors: high-spectral-resolution diffuse optical spectroscopy,” Radiology 254(1), 277–284 (2010).
[Crossref] [PubMed]

2009 (3)

P. O. Brown and C. Palmer, “The preclinical natural history of serous ovarian cancer: defining the target for early detection,” PLoS Med. 6(7), e1000114 (2009).
[Crossref] [PubMed]

H. Hayashi, K. Ashizawa, M. Uetani, S. Futagawa, A. Fukushima, K. Minami, S. Honda, and K. Hayashi, “Detectability of peripheral lung cancer on chest radiographs: effect of the size, location and extent of ground-glass opacity,” Br. J. Radiol. 82(976), 272–278 (2009).
[Crossref] [PubMed]

M. Mancini, E. Vergara, G. Salvatore, A. Greco, G. Troncone, A. Affuso, R. Liuzzi, P. Salerno, M. Scotto di Santolo, M. Santoro, A. Brunetti, and M. Salvatore, “Morphological ultrasound microimaging of thyroid in living mice,” Endocrinology 150(10), 4810–4815 (2009).
[Crossref] [PubMed]

2008 (3)

A. Bozzini, G. Renne, L. Meneghetti, G. Bandi, G. Santos, A. R. Vento, S. Menna, S. Andrighetto, G. Viale, E. Cassano, and M. Bellomi, “Sensitivity of imaging for multifocal-multicentric breast carcinoma,” BMC Cancer 8(1), 275 (2008).
[Crossref] [PubMed]

N. S. Makarov, M. Drobizhev, and A. Rebane, “Two-photon absorption standards in the 550-1600 nm excitation wavelength range,” Opt. Express 16(6), 4029–4047 (2008).
[Crossref] [PubMed]

N. S. Makarov, E. Beuerman, M. Drobizhev, J. Starkey, and A. Rebane, “Environment-sensitive two-photon dye,” Proc. SPIE 7049, 70490Y (2008).
[Crossref]

2007 (1)

R. Ramadass and J. Bereiter-Hahn, ““Photophysical properties of DASPMI as revealed by spectrally resolved fluorescence decays,” J. Phys. B 111(26), 7681–7690 (2007).
[Crossref]

2006 (2)

V. P. Tokar, M. Y. Losytskyy, V. B. Kovalska, D. V. Kryvorotenko, A. O. Balanda, V. M. Prokopets, M. P. Galak, I. M. Dmytruk, V. M. Yashchuk, and S. M. Yarmoluk, “Fluorescence of styryl dyes-DNA complexes induced by single- and two-photon excitation,” J. Fluoresc. 16(6), 783–791 (2006).
[Crossref] [PubMed]

P. D. Eckford and F. J. Sharom, “P-glycoprotein (ABCB1) interacts directly with lipid-based anti-cancer drugs and platelet-activating factors,” Biochem. Cell Biol. 84(6), 1022–1033 (2006).
[Crossref] [PubMed]

2005 (2)

M. R. Lugo and F. J. Sharom, “Interaction of LDS-751 with P-glycoprotein and mapping of the location of the R drug binding site,” Biochemistry 44(2), 643–655 (2005).
[Crossref] [PubMed]

P. S. Adusumilli, D. P. Eisenberg, Y. S. Chun, K. W. Ryu, L. Ben-Porat, K. J. Hendershott, M. K. Chan, R. Huq, C. C. Riedl, and Y. Fong, “Virally directed fluorescent imaging improves diagnostic sensitivity in the detection of minimal residual disease after potentially curative cytoreductive surgery,” J. Gastrointest. Surg. 9(8), 1138–1147 (2005).
[Crossref] [PubMed]

2004 (1)

S. Achilefu, “Lighting up tumors with receptor-specific optical molecular probes,” Technol. Cancer Res. Treat. 3(4), 393–409 (2004).
[PubMed]

2003 (1)

J. M. Song, R. Jagannathan, D. L. Stokes, P. M. Kasili, M. Panjehpour, M. N. Phan, B. F. Overholt, R. C. DeNovo, X. Pan, R. J. Lee, and T. Vo-Dinh, “Development of a fluorescence detection system using optical parametric oscillator (OPO) laser excitation for in vivo diagnosis,” Technol. Cancer Res. Treat. 2(6), 515–523 (2003).
[PubMed]

2002 (1)

L. Josephson, M. F. Kircher, U. Mahmood, Y. Tang, and R. Weissleder, “Near-infrared fluorescent nanoparticles as combined MR/optical imaging probes,” Bioconjug. Chem. 13(3), 554–560 (2002).
[Crossref] [PubMed]

2001 (2)

K. Licha, C. Hessenius, A. Becker, P. Henklein, M. Bauer, S. Wisniewski, B. Wiedenmann, and W. Semmler, “Synthesis, characterization, and biological properties of cyanine-labeled somatostatin analogues as receptor-targeted fluorescent probes,” Bioconjug. Chem. 12(1), 44–50 (2001).
[Crossref] [PubMed]

J. E. Bugaj, S. Achilefu, R. B. Dorshow, and R. Rajagopalan, “Novel fluorescent contrast agents for optical imaging of in vivo tumors based on a receptor-targeted dye-peptide conjugate platform,” J. Biomed. Opt. 6(2), 122–133 (2001).
[Crossref] [PubMed]

2000 (1)

S. Achilefu, R. B. Dorshow, J. E. Bugaj, and R. Rajagopalan, “Novel receptor-targeted fluorescent contrast agents for in vivo tumor imaging,” Invest. Radiol. 35(8), 479–485 (2000).
[Crossref] [PubMed]

1989 (1)

N. P. Robertson, J. R. Starkey, S. Hamner, and G. G. Meadows, “Tumor cell invasion of three-dimensional matrices of defined composition: evidence for a specific role for heparan sulfate in rodent cell lines,” Cancer Res. 49(7), 1816–1823 (1989).
[PubMed]

1988 (1)

O. A. Oredipe, R. F. Barth, S. E. Tuttle, D. M. Adams, I. Sautins, D. M. Bucci, C. M. Mojzisik, G. H. Hinkle, S. Jewell, Z. Steplewski, M. O. Thurston, and E. W. Martin, “Limits of sensitivity for the radioimmunodetection of colon cancer by means of a hand held gamma probe” Int. J. Rad. Appl. Instrum. Part B. Nucl. Med. Biol. 15, 595–603 (1988).

1986 (1)

W. Jones and H. L. Hosick, “Collagen concentration as a significant variable for growth and morphology of mouse mammary parenchyma in collagen matrix culture,” Cell Biol. Int. Rep. 10(4), 277–286 (1986).
[Crossref] [PubMed]

1981 (2)

L. W. Anderson, K. G. Danielson, and H. L. Hosick, “Metastatic potential of hyperplastic alveolar nodule derived mouse mammary tumor cells following intravenous inoculation,” Eur. J. Cancer Clin. Oncol. 17(9), 1001–1008 (1981).
[Crossref] [PubMed]

H. Birkedal-Hansen and K. Danø, “A sensitive collagenase assay using [3H] collagen labeled by reaction with pyridoxal phosphate and [3H] borohydride,” Anal. Biochem. 115(1), 18–26 (1981).
[Crossref] [PubMed]

1980 (2)

K. G. Danielson, L. W. Anderson, and H. L. Hosick, “Selection and characterization in culture of mammary tumor cells with distinctive growth properties in vivo,” Cancer Res. 40(6), 1812–1819 (1980).
[PubMed]

S. L. Schor, “Cell proliferation and migration on collagen substrata in vitro,” J. Cell Sci. 41, 159–175 (1980).
[PubMed]

1974 (1)

R. B. Owens, H. S. Smith, and A. J. Hackett, “Epithelial cell cultures from normal glandular tissue of mice,” J. Natl. Cancer Inst. 53(1), 261–269 (1974).
[PubMed]

Achilefu, S.

S. Achilefu, “Lighting up tumors with receptor-specific optical molecular probes,” Technol. Cancer Res. Treat. 3(4), 393–409 (2004).
[PubMed]

Adams, D. M.

Adrada, B. E.

Adusumilli, P. S.

Affuso, A.

Almog, N.

N. Almog, “Molecular mechanisms underlying tumor dormancy,” Cancer Lett. 294(2), 139–146 (2010).
[Crossref] [PubMed]

Anderson, L. W.

Andrighetto, S.

Arribas, E.

Ashizawa, K.

Balanda, A. O.

Bandi, G.

Barth, R. F.

Bauer, M.

Becker, A.

Bellomi, M.

Ben-Porat, L.

Bereiter-Hahn, J.

R. Ramadass and J. Bereiter-Hahn, ““Photophysical properties of DASPMI as revealed by spectrally resolved fluorescence decays,” J. Phys. B 111(26), 7681–7690 (2007).
[Crossref]

Berezin, M. Y.

Beuerman, E.

N. S. Makarov, E. Beuerman, M. Drobizhev, J. Starkey, and A. Rebane, “Environment-sensitive two-photon dye,” Proc. SPIE 7049, 70490Y (2008).
[Crossref]

Birkedal-Hansen, H.

Bozzini, A.

Brown, P. O.

P. O. Brown and C. Palmer, “The preclinical natural history of serous ovarian cancer: defining the target for early detection,” PLoS Med. 6(7), e1000114 (2009).
[Crossref] [PubMed]

Brunetti, A.

Bucci, D. M.

Bugaj, J. E.

Carkaci, S.

Cassano, E.

Cerussi, A. E.

Chan, M. K.

Chuang, H. H.

Chun, Y. S.

Danielson, K. G.

Danø, K.

DeNovo, R. C.

Dmytruk, I. M.

Dorshow, R. B.

Dowsett, M.

M. T. Weigel and M. Dowsett, “Current and emerging biomarkers in breast cancer: prognosis and prediction,” Endocr. Relat. Cancer 17(4), R245–R262 (2010).
[Crossref] [PubMed]

Drobizhev, M.

N. S. Makarov, E. Beuerman, M. Drobizhev, J. Starkey, and A. Rebane, “Environment-sensitive two-photon dye,” Proc. SPIE 7049, 70490Y (2008).
[Crossref]

N. S. Makarov, M. Drobizhev, and A. Rebane, “Two-photon absorption standards in the 550-1600 nm excitation wavelength range,” Opt. Express 16(6), 4029–4047 (2008).
[Crossref] [PubMed]

Drobizhev, M. A.

Eckford, P. D.

Ehlis, A. C.

Eisenberg, D. P.

Fallgatter, A. J.

Fong, Y.

Fukushima, A.

Futagawa, S.

Galak, M. P.

Gratton, E.

Greco, A.

Hackett, A. J.

R. B. Owens, H. S. Smith, and A. J. Hackett, “Epithelial cell cultures from normal glandular tissue of mice,” J. Natl. Cancer Inst. 53(1), 261–269 (1974).
[PubMed]

Hadjipanayis, C. G.

Haeussinger, F. B.

Hahn, T.

Hamner, S.

Hayashi, H.

Hayashi, K.

Heinzel, S.

Hendershott, K. J.

Henklein, P.

Hessenius, C.

Hinkle, G. H.

Honda, S.

Hosick, H. L.

Hsiang, D.

Huq, R.

Jagannathan, R.

Jewell, S.

Jiang, H.

Jones, W.

Josephson, L.

Kasili, P. M.

Khatri, A.

Kircher, M. F.

Kovalska, V. B.

Kryvorotenko, D. V.

Kukreti, S.

Lee, R. J.

Licha, K.

Liu, Y.

Liuzzi, R.

Losytskyy, M. Y.

Lugo, M. R.

M. R. Lugo and F. J. Sharom, “Interaction of LDS-751 with P-glycoprotein and mapping of the location of the R drug binding site,” Biochemistry 44(2), 643–655 (2005).
[Crossref] [PubMed]

Mahmood, U.

Makarov, N. S.

N. S. Makarov, E. Beuerman, M. Drobizhev, J. Starkey, and A. Rebane, “Environment-sensitive two-photon dye,” Proc. SPIE 7049, 70490Y (2008).
[Crossref]

N. S. Makarov, M. Drobizhev, and A. Rebane, “Two-photon absorption standards in the 550-1600 nm excitation wavelength range,” Opt. Express 16(6), 4029–4047 (2008).
[Crossref] [PubMed]

Mancini, M.

Martin, E. W.

Martiniello-Wilks, R.

Mawlawi, O. R.

Meadows, G. G.

Meneghetti, L.

Menna, S.

Minami, K.

Mojzisik, C. M.

Nacke, C.

Oredipe, O. A.

Overholt, B. F.

Owens, R. B.

R. B. Owens, H. S. Smith, and A. J. Hackett, “Epithelial cell cultures from normal glandular tissue of mice,” J. Natl. Cancer Inst. 53(1), 261–269 (1974).
[PubMed]

Pahapill, J.

Palmer, C.

P. O. Brown and C. Palmer, “The preclinical natural history of serous ovarian cancer: defining the target for early detection,” PLoS Med. 6(7), e1000114 (2009).
[Crossref] [PubMed]

Pan, X.

Panjehpour, M.

Phan, M. N.

Prokopets, V. M.

Rajagopalan, R.

Ramadass, R.

R. Ramadass and J. Bereiter-Hahn, ““Photophysical properties of DASPMI as revealed by spectrally resolved fluorescence decays,” J. Phys. B 111(26), 7681–7690 (2007).
[Crossref]

Rasko, J. E.

Rebane, A.

N. S. Makarov, E. Beuerman, M. Drobizhev, J. Starkey, and A. Rebane, “Environment-sensitive two-photon dye,” Proc. SPIE 7049, 70490Y (2008).
[Crossref]

N. S. Makarov, M. Drobizhev, and A. Rebane, “Two-photon absorption standards in the 550-1600 nm excitation wavelength range,” Opt. Express 16(6), 4029–4047 (2008).
[Crossref] [PubMed]

Renne, G.

Riedl, C. C.

Roberts, D. W.

Robertson, N. P.

Rohren, E. M.

Russell, P. J.

Ryu, K. W.

Salerno, P.

Salvatore, G.

Salvatore, M.

Santiago, L.

Santoro, M.

Santos, G.

Sautins, I.

Schecklmann, M.

Schor, S. L.

S. L. Schor, “Cell proliferation and migration on collagen substrata in vitro,” J. Cell Sci. 41, 159–175 (1980).
[PubMed]

Scotto di Santolo, M.

Semmler, W.

Sharom, F. J.

M. R. Lugo and F. J. Sharom, “Interaction of LDS-751 with P-glycoprotein and mapping of the location of the R drug binding site,” Biochemistry 44(2), 643–655 (2005).
[Crossref] [PubMed]

Shkumat, N. A.

Smith, H. S.

R. B. Owens, H. S. Smith, and A. J. Hackett, “Epithelial cell cultures from normal glandular tissue of mice,” J. Natl. Cancer Inst. 53(1), 261–269 (1974).
[PubMed]

Solomon, M.

Song, J. M.

Springer, A.

Starkey, J.

N. S. Makarov, E. Beuerman, M. Drobizhev, J. Starkey, and A. Rebane, “Environment-sensitive two-photon dye,” Proc. SPIE 7049, 70490Y (2008).
[Crossref]

Starkey, J. R.

Steplewski, Z.

Stokes, D. L.

Tanamai, W.

Tang, C.

Tang, Y.

Thurston, M. O.

Tokar, V. P.

Tromberg, B. J.

Troncone, G.

Tuttle, S. E.

Uetani, M.

Vento, A. R.

Vergara, E.

Viale, G.

Vo-Dinh, T.

Walker, C. M.

Weigel, M. T.

M. T. Weigel and M. Dowsett, “Current and emerging biomarkers in breast cancer: prognosis and prediction,” Endocr. Relat. Cancer 17(4), R245–R262 (2010).
[Crossref] [PubMed]

Weissleder, R.

Wiedenmann, B.

Wisniewski, S.

Yang, L.

Yang, W. T.

Yarmoluk, S. M.

Yashchuk, V. M.

Anal. Biochem. (1)

Biochem. Cell Biol. (1)

Biochemistry (1)

M. R. Lugo and F. J. Sharom, “Interaction of LDS-751 with P-glycoprotein and mapping of the location of the R drug binding site,” Biochemistry 44(2), 643–655 (2005).
[Crossref] [PubMed]

Bioconjug. Chem. (2)

BMC Cancer (1)

Br. J. Radiol. (1)

Cancer Lett. (1)

N. Almog, “Molecular mechanisms underlying tumor dormancy,” Cancer Lett. 294(2), 139–146 (2010).
[Crossref] [PubMed]

Cancer Res. (2)

Cell Biol. Int. Rep. (1)

Endocr. Relat. Cancer (1)

M. T. Weigel and M. Dowsett, “Current and emerging biomarkers in breast cancer: prognosis and prediction,” Endocr. Relat. Cancer 17(4), R245–R262 (2010).
[Crossref] [PubMed]

Endocrinology (1)

Eur. J. Cancer Clin. Oncol. (1)

Int. J. Rad. Appl. Instrum. Part B. Nucl. Med. Biol. (1)

Invest. Radiol. (1)

J. Biomed. Opt. (1)

J. Cell Sci. (1)

S. L. Schor, “Cell proliferation and migration on collagen substrata in vitro,” J. Cell Sci. 41, 159–175 (1980).
[PubMed]

J. Fluoresc. (1)

J. Gastrointest. Surg. (1)

J. Lumin. (1)

J. Natl. Cancer Inst. (1)

R. B. Owens, H. S. Smith, and A. J. Hackett, “Epithelial cell cultures from normal glandular tissue of mice,” J. Natl. Cancer Inst. 53(1), 261–269 (1974).
[PubMed]

J. Phys. B (1)

R. Ramadass and J. Bereiter-Hahn, ““Photophysical properties of DASPMI as revealed by spectrally resolved fluorescence decays,” J. Phys. B 111(26), 7681–7690 (2007).
[Crossref]

Med. Phys. (1)

Med. Princ. Pract. (1)

Opt. Express (1)

N. S. Makarov, M. Drobizhev, and A. Rebane, “Two-photon absorption standards in the 550-1600 nm excitation wavelength range,” Opt. Express 16(6), 4029–4047 (2008).
[Crossref] [PubMed]

PLoS Med. (1)

P. O. Brown and C. Palmer, “The preclinical natural history of serous ovarian cancer: defining the target for early detection,” PLoS Med. 6(7), e1000114 (2009).
[Crossref] [PubMed]

PLoS ONE (1)

Proc. SPIE (1)

N. S. Makarov, E. Beuerman, M. Drobizhev, J. Starkey, and A. Rebane, “Environment-sensitive two-photon dye,” Proc. SPIE 7049, 70490Y (2008).
[Crossref]

Radiology (1)

Semin. Oncol. (1)

Stem Cells (1)

Technol. Cancer Res. Treat. (2)

S. Achilefu, “Lighting up tumors with receptor-specific optical molecular probes,” Technol. Cancer Res. Treat. 3(4), 393–409 (2004).
[PubMed]

Other (4)

R. C. Hallowes, E. S. Bone, and W. Jones, “A new dimension in the culture of human breast,” in Tissue Culture in Medical Research II, R. J. Richards and K. T. Rajan, eds. (Pergamon, Oxford, 1980), pp. 213-220.

“Primer3,” http://frodo.wi.mit.edu/primer3/input.htm .

“ImageJ,” http://rsbweb.nih.gov/ij/

C. D. M. Fletcher, ed., Diagnostic Histopathology of Tumors (Churchill Livingstone, 2007).

Cited By

OSA participates in Crossref's Cited-By Linking service. Citing articles from OSA journals and other participating publishers are listed here.

Alert me when this article is cited.

Click here to see a list of articles that cite this paper

Fig. 1

Properties of the tissue phantoms. (a) General view of a collagen type I based phantom consisting of collagen matrix (lower half) and serum medium containing Styryl-9M (upper half); (b) a normal mouse mammary epithelial cell colony in a phantom after 2 days of incubation; (c) high magnification image of normal mouse mammary epithelial cell colony after 14 days of incubation.

Download Full Size | PPT Slide | PDF

Fig. 2

Schematic of the imaging setup. ND, variable neutral density filter; ID, iris diaphragm; L1, focusing lens; OB, imaging objective (camera lens or microscope objective); SF, spectral filter; CCD, imaging detector. Inserts show the mouse ear tumor (a) and the near-IR laser spot (b); 2PEF in a dye-doped plastic film positioned in front of the tumor visualizes the laser beam.

Download Full Size | PPT Slide | PDF

Fig. 3

(a) 2PA spectrum of Styryl-9M in chloroform (black line), shown as 2PA cross section (left y-axis) versus laser wavelength (bottom x-axis). 1PA extinction spectrum (blue dotted line) and fluorescence emission spectrum (red line) in chloroform; (b) 2PEF spectra in tissue phantoms with no cells (black squares), with normal cells (red circles), and with cancer cells (blue triangles), all normalized at 1100 nm and presented in arbitrary units.

Download Full Size | PPT Slide | PDF

Fig. 4

Dependence of the fluorescence intensity ratio (2) on the x-distance across the phantom. (a) Homogeneous phantoms with uniform distribution of the cells throughout the collagen matrix. The coding of the colony types is shown in the inset. (b) Phantoms containing, in addition to normal cells, a single implanted colony of cancer cells. Distance is measured from the center of the phantom. Vertical dashed lines indicate approximate margins of the initially implanted cancer colony. The laser beam had a symmetrical Gaussian spatial profile with FWHM of ~200 μm. The excitation beam propagates from right to left.

Download Full Size | PPT Slide | PDF

Fig. 5

Estimation of the smallest number of cancer cells that can be detected as a colony in the phantom. Horizontal axes – estimated number of cancer cells in the implanted colony; Horizontal dotted line indicates the empirical threshold for the discrimination between the cancer-containing and cancer-free samples; (a) +SA cancer line. Solid curve: fit parameters used, F^U = 0.55, F^B = 0.95, N = 10⁶, N_Pgp = 40,000 and ΔE/kT = 16.0; (b) NIHOVCAR3 cancer line.

Download Full Size | PPT Slide | PDF

Fig. 6

Fluorescence image of 4T1 cells stained with anti p-glycoprotein antibody and Alexa Fluor 568 protein A.

Download Full Size | PPT Slide | PDF

Fig. 7

Dual wavelength 2PEF imaging of the pinna of the mouse ear with the laser beam perpendicular to the pinna. Panels (a) and (c) show the image and the integrated intensity trace for an apparently normal region of the pinna of the ear; Panels (b) and (d) show the same for a region containing the 4T1 tumor.

Download Full Size | PPT Slide | PDF

Tables (3)

Table 1 Primers used in the real time PCR analysis

View Table | View all tables in this article

Table 3 PCR expression analysis for MDR1 proteins

View Table | View all tables in this article

Table 2 Relative fluorescence for MDR1

View Table | View all tables in this article

Equations (8)

Equations on this page are rendered with MathJax. Learn more.

F (x_{i}, y_{j}) = \frac{I_{1200} (x_{i}, y_{j})}{I_{1100} (x_{i}, y_{j})} .

\tilde{F} (x_{i}) = \frac{I_{1200} (x_{i}) - I_{B} (x_{i})}{I_{1100} (x_{i}) - I_{B} (x_{i})} {(\frac{P_{1100}}{P_{1200}})}^{2},

I (x_{i}) = \sum_{j = 1}^{M} I (x_{i}, y_{j}),

F = \frac{σ_{2}^{B} (1200) ϕ^{B} N^{B} + σ_{2}^{U} (1200) ϕ^{U} N^{U}}{σ_{2}^{U} (1100) ϕ^{B} N^{B} + σ_{2}^{U} (1100) ϕ^{U} N^{U}},

σ_{2}^{B} (1100) ϕ^{B} = σ_{2}^{U} (1100) ϕ^{U} .

F = \frac{σ_{2}^{U} (1200)}{σ_{2}^{U} (1100)} + \frac{N^{B}}{N} (\frac{σ_{2}^{B} (1200)}{σ_{2}^{B} (1100)} - \frac{σ_{2}^{U} (1200)}{σ_{2}^{U} (1100)}),

e^{- \frac{Δ E}{k T}} = \frac{N^{B}}{(N - N^{B}) (N_{P g p} N_{c} - N^{B})},

F (N_{c}) = F^{U} + (F^{B} - F^{U}) \frac{1 + (N + {\bar{N}}_{P g p} N_{c}) e^{- \frac{Δ E}{k T}} - \sqrt{{[1 + (N + {\bar{N}}_{P g p} N_{c}) e^{- \frac{Δ E}{k T}}]}^{2} - 4 N {\bar{N}}_{P g p} N_{c} e^{- \frac{2 Δ E}{k T}}}}{2 N e^{- \frac{Δ E}{k T}}},

Gene transcript	Forward primer	Reverse primer
Human MDR1 long	TGACATTTATTCAAAGTTAAAAGC	TAGACACTTTATGCAAACATTTCAA
Human MDR1 short	AAATTGGCTTGACAAGTTGTATATGG	CACCAGCATCATGAGAGGAAGTC
Mouse MDR1A	AAATTGGCTTGACAAGTTGTATATGG	TGTGCTCTCTTCCCGCAGCCAC
Mouse MDR1B	AAATTGGCTTGACAAGTTGTATATGG	CTCGGCCATCGTGGTGGCAA
Human HPRT	Validated primers from Integrated DNA Technologies
Human GAPDH
Mouse RPL23

Cell line	Gene transcript	Relative expression normalized to the housekeeping gene	Housekeeping gene
MDA-MB-231	MDR1 long	00.19	HPRT
NIHOVCAR3	MDR1 long	00.94	HPRT
MDA-MB-231	MDR1 long	00.31	GAPDH
NIHOVCAR3	MDR1 short	18.10	GAPDH
Norm. mouse mam. epith.	MDR1A	00.52	RPL23
+SA	MDR1A	03.93	RPL23
4T1	MDR1A	03.36	RPL23
Norm. mouse mam. epith.	MDR1B	05.56	RPL23
+SA	MDR1B	16.10	RPL23
4T1	MDR1B	12.40	RPL23

Cell line	Average p-glycoprotein fluorescent signal
4T1	24.2
MDA-MB-231	17.3
+SA	4.6
Normal mouse mammary epithelium	2.2

Gene transcript	Forward primer	Reverse primer
Human MDR1 long	TGACATTTATTCAAAGTTAAAAGC	TAGACACTTTATGCAAACATTTCAA
Human MDR1 short	AAATTGGCTTGACAAGTTGTATATGG	CACCAGCATCATGAGAGGAAGTC
Mouse MDR1A	AAATTGGCTTGACAAGTTGTATATGG	TGTGCTCTCTTCCCGCAGCCAC
Mouse MDR1B	AAATTGGCTTGACAAGTTGTATATGG	CTCGGCCATCGTGGTGGCAA
Human HPRT	Validated primers from Integrated DNA Technologies
Human GAPDH
Mouse RPL23

Cell line	Gene transcript	Relative expression normalized to the housekeeping gene	Housekeeping gene
MDA-MB-231	MDR1 long	00.19	HPRT
NIHOVCAR3	MDR1 long	00.94	HPRT
MDA-MB-231	MDR1 long	00.31	GAPDH
NIHOVCAR3	MDR1 short	18.10	GAPDH
Norm. mouse mam. epith.	MDR1A	00.52	RPL23
+SA	MDR1A	03.93	RPL23
4T1	MDR1A	03.36	RPL23
Norm. mouse mam. epith.	MDR1B	05.56	RPL23
+SA	MDR1B	16.10	RPL23
4T1	MDR1B	12.40	RPL23